Transcript: Human XM_006714810.3

PREDICTED: Homo sapiens neuregulin 2 (NRG2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRG2 (9542)
Length:
1901
CDS:
597..1865

Additional Resources:

NCBI RefSeq record:
XM_006714810.3
NBCI Gene record:
NRG2 (9542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714810.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058863 GCCGAGACATTCGCATCAAAT pLKO.1 1435 CDS 100% 13.200 18.480 N NRG2 n/a
2 TRCN0000434416 CAGAAAGAACTCACGACTACA pLKO_005 1466 CDS 100% 4.950 3.960 N NRG2 n/a
3 TRCN0000455012 TCGAAAGGAACCAGCGCTACA pLKO_005 1159 CDS 100% 4.050 3.240 N NRG2 n/a
4 TRCN0000433268 TAGTCTTTAAGACGGCCTTTG pLKO_005 1210 CDS 100% 6.000 4.200 N NRG2 n/a
5 TRCN0000058866 CGGACAGAGATGTTTGGAGAA pLKO.1 1727 CDS 100% 4.050 2.835 N NRG2 n/a
6 TRCN0000446019 GGGTGAGAAGCAATCGCTGAA pLKO_005 1343 CDS 100% 4.050 2.835 N NRG2 n/a
7 TRCN0000058867 GCCAAGTCCTATTGCGTCAAT pLKO.1 1641 CDS 100% 4.950 2.970 N NRG2 n/a
8 TRCN0000058865 GCCCAAGTTGAAGAAGATGAA pLKO.1 1304 CDS 100% 4.950 2.970 N NRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714810.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.