Transcript: Human XM_006715659.1

PREDICTED: Homo sapiens thrombospondin type 1 domain containing 7A (THSD7A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THSD7A (221981)
Length:
10496
CDS:
252..5096

Additional Resources:

NCBI RefSeq record:
XM_006715659.1
NBCI Gene record:
THSD7A (221981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263251 AGATCCAGACCGGTGATTATA pLKO_005 4581 CDS 100% 15.000 21.000 N THSD7A n/a
2 TRCN0000263252 ATGCCGACATGTAACATATAA pLKO_005 5124 3UTR 100% 15.000 21.000 N THSD7A n/a
3 TRCN0000263250 GACCGCAGCAAAGGAGTAAAG pLKO_005 1107 CDS 100% 10.800 15.120 N THSD7A n/a
4 TRCN0000263249 TCAAAGGTCAGATGGTATAAA pLKO_005 4730 CDS 100% 15.000 10.500 N THSD7A n/a
5 TRCN0000263253 TTGACAACATGGCGGTAATTT pLKO_005 6159 3UTR 100% 15.000 10.500 N THSD7A n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7854 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.