Transcript: Human XM_006715855.1

PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUX1 (1523)
Length:
3282
CDS:
117..2414

Additional Resources:

NCBI RefSeq record:
XM_006715855.1
NBCI Gene record:
CUX1 (1523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417782 TAAGGTTCAGAGCCTACAAAC pLKO_005 1001 CDS 100% 10.800 15.120 N CUX1 n/a
2 TRCN0000013752 CGAAACCATAGCTCTTGAGAA pLKO.1 887 CDS 100% 4.950 6.930 N CUX1 n/a
3 TRCN0000426139 GATCATGACGGACCTTGAAAG pLKO_005 1109 CDS 100% 10.800 8.640 N CUX1 n/a
4 TRCN0000428064 ACCGATTCCAGCTGCGGTTAA pLKO_005 2750 3UTR 100% 10.800 7.560 N CUX1 n/a
5 TRCN0000435424 AGAAGTTACAGAATGACTTTG pLKO_005 913 CDS 100% 10.800 7.560 N CUX1 n/a
6 TRCN0000413385 AGATCCCAGAGCCCATCAAAG pLKO_005 1786 CDS 100% 10.800 7.560 N CUX1 n/a
7 TRCN0000013751 CGGCTTCTTCTACACACTGTT pLKO.1 2237 CDS 100% 4.950 3.465 N CUX1 n/a
8 TRCN0000013750 GCACGATATTGAAACAGAGAA pLKO.1 740 CDS 100% 4.950 3.465 N CUX1 n/a
9 TRCN0000013749 GCCGACAACATCAAGCTCTTT pLKO.1 2001 CDS 100% 4.950 3.465 N CUX1 n/a
10 TRCN0000013748 GCTTTCTTCTTTAGCAAGATA pLKO.1 3038 3UTR 100% 5.625 3.375 N CUX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.