Transcript: Human XM_006716083.2

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 11 (GALNT11), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT11 (63917)
Length:
2623
CDS:
129..1955

Additional Resources:

NCBI RefSeq record:
XM_006716083.2
NBCI Gene record:
GALNT11 (63917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034643 GATGTGATAGACAGTCGTGTT pLKO.1 360 CDS 100% 4.050 5.670 N GALNT11 n/a
2 TRCN0000299936 GATGTGATAGACAGTCGTGTT pLKO_005 360 CDS 100% 4.050 5.670 N GALNT11 n/a
3 TRCN0000034640 CCAAAGTCCTTCAACGTGGAA pLKO.1 1558 CDS 100% 2.640 3.696 N GALNT11 n/a
4 TRCN0000034642 CCCAAATCAGATCTGGATCTA pLKO.1 1676 CDS 100% 4.950 3.960 N GALNT11 n/a
5 TRCN0000299885 CCCAAATCAGATCTGGATCTA pLKO_005 1676 CDS 100% 4.950 3.960 N GALNT11 n/a
6 TRCN0000034641 GCTCTAGAGTAGGACACATTT pLKO.1 1246 CDS 100% 13.200 9.240 N GALNT11 n/a
7 TRCN0000299938 GCTCTAGAGTAGGACACATTT pLKO_005 1246 CDS 100% 13.200 9.240 N GALNT11 n/a
8 TRCN0000034639 GCCACAGTTCAAAGCAAACAA pLKO.1 332 CDS 100% 5.625 3.938 N GALNT11 n/a
9 TRCN0000299937 GCCACAGTTCAAAGCAAACAA pLKO_005 332 CDS 100% 5.625 3.938 N GALNT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.