Transcript: Human XM_006716651.3

PREDICTED: Homo sapiens collagen type XIV alpha 1 chain (COL14A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL14A1 (7373)
Length:
7866
CDS:
134..5524

Additional Resources:

NCBI RefSeq record:
XM_006716651.3
NBCI Gene record:
COL14A1 (7373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371866 GCTCTAACAGTGCTCGATTAA pLKO_005 1773 CDS 100% 13.200 10.560 N COL14A1 n/a
2 TRCN0000371865 ATGAACGCATCAGCTAATATC pLKO_005 4280 CDS 100% 13.200 9.240 N COL14A1 n/a
3 TRCN0000116559 CCAGAATTACACAGTTCAAAT pLKO.1 409 CDS 100% 13.200 9.240 N COL14A1 n/a
4 TRCN0000116561 GCATTGATCTTGCAGGATTTA pLKO.1 3804 CDS 100% 13.200 9.240 N COL14A1 n/a
5 TRCN0000371811 GGTTGAAGTCGATCCTATTAC pLKO_005 1870 CDS 100% 13.200 9.240 N COL14A1 n/a
6 TRCN0000116560 CCGTTCCAGTTACAGATGTTT pLKO.1 4367 CDS 100% 5.625 3.938 N COL14A1 n/a
7 TRCN0000116557 GCTTTCTGAATTTGGTAGTTT pLKO.1 6089 3UTR 100% 5.625 3.938 N COL14A1 n/a
8 TRCN0000116558 CCTCCCATATAAAGGAGGAAA pLKO.1 814 CDS 100% 0.495 0.347 N COL14A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.