Transcript: Human XM_006717027.3

PREDICTED: Homo sapiens solute carrier family 44 member 1 (SLC44A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC44A1 (23446)
Length:
2229
CDS:
16..2229

Additional Resources:

NCBI RefSeq record:
XM_006717027.3
NBCI Gene record:
SLC44A1 (23446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160301 CAGCGGAAGTATGTATTCTTT pLKO.1 331 CDS 100% 5.625 7.875 N SLC44A1 n/a
2 TRCN0000162245 CCGCGAATGATCCTTATGTAT pLKO.1 1435 CDS 100% 5.625 7.875 N SLC44A1 n/a
3 TRCN0000159306 GAAATGGTAGTGGATGTATTA pLKO.1 1840 CDS 100% 13.200 10.560 N SLC44A1 n/a
4 TRCN0000159556 GCATTGGGATGGGATTTATTT pLKO.1 185 CDS 100% 15.000 10.500 N SLC44A1 n/a
5 TRCN0000166130 CCATGCAACCTGGACTTGATA pLKO.1 358 CDS 100% 5.625 3.938 N SLC44A1 n/a
6 TRCN0000166060 GAGCAGCTTCAGATAGCTGAA pLKO.1 898 CDS 100% 0.405 0.284 N SLC44A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.