Transcript: Human XM_006717084.3

PREDICTED: Homo sapiens solute carrier family 2 member 8 (SLC2A8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A8 (29988)
Length:
1836
CDS:
89..1402

Additional Resources:

NCBI RefSeq record:
XM_006717084.3
NBCI Gene record:
SLC2A8 (29988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043664 CCCGGTCTACATCTCCGAAAT pLKO.1 511 CDS 100% 10.800 15.120 N SLC2A8 n/a
2 TRCN0000300178 CCCGGTCTACATCTCCGAAAT pLKO_005 511 CDS 100% 10.800 15.120 N SLC2A8 n/a
3 TRCN0000043663 GCTCCTCATGTCAGAGATCTT pLKO.1 1270 CDS 100% 4.950 3.465 N SLC2A8 n/a
4 TRCN0000300122 GCTCCTCATGTCAGAGATCTT pLKO_005 1270 CDS 100% 4.950 3.465 N SLC2A8 n/a
5 TRCN0000043665 GCTGCTTCTCATGTGCTTCAT pLKO.1 673 CDS 100% 4.950 3.465 N SLC2A8 n/a
6 TRCN0000174074 GCTGCTTCTCATGTGCTTCAT pLKO.1 673 CDS 100% 4.950 3.465 N SLC2A8 n/a
7 TRCN0000300180 GCTGCTTCTCATGTGCTTCAT pLKO_005 673 CDS 100% 4.950 3.465 N SLC2A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.