Transcript: Human XM_006717143.2

PREDICTED: Homo sapiens PHD finger protein 2 (PHF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF2 (5253)
Length:
5241
CDS:
142..3330

Additional Resources:

NCBI RefSeq record:
XM_006717143.2
NBCI Gene record:
PHF2 (5253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218020 CATAGAATGTAGCGTGTAAAT pLKO_005 4356 3UTR 100% 13.200 18.480 N PHF2 n/a
2 TRCN0000019236 CATCTTTAAGTCCCGGTCGAA pLKO.1 2700 CDS 100% 2.640 3.696 N PHF2 n/a
3 TRCN0000230572 AGCTCAAGATCGACGAGTTTC pLKO_005 2090 CDS 100% 10.800 8.640 N PHF2 n/a
4 TRCN0000218350 GAAGGAGTTTGTGGACTATTA pLKO_005 663 CDS 100% 13.200 9.240 N PHF2 n/a
5 TRCN0000230570 CCCATGGGAAGTCCACCTTAA pLKO_005 308 CDS 100% 10.800 7.560 N PHF2 n/a
6 TRCN0000019238 GAACGGGAAACTACTCCTTTA pLKO.1 3309 CDS 100% 10.800 7.560 N PHF2 n/a
7 TRCN0000019234 GCATTCAAAGGCTCTCACAAA pLKO.1 1174 CDS 100% 4.950 3.465 N PHF2 n/a
8 TRCN0000019235 GCAGAACTTCAAGGAGGACAA pLKO.1 2022 CDS 100% 4.050 2.835 N PHF2 n/a
9 TRCN0000019237 GTAAAGAAACTGTCATGGGTA pLKO.1 775 CDS 100% 2.640 1.848 N PHF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717143.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.