Transcript: Human XM_006717182.1

PREDICTED: Homo sapiens CDK5 regulatory subunit associated protein 2 (CDK5RAP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK5RAP2 (55755)
Length:
6128
CDS:
182..5767

Additional Resources:

NCBI RefSeq record:
XM_006717182.1
NBCI Gene record:
CDK5RAP2 (55755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323240 AGTGCAGTGAGGCCATAATTA pLKO_005 3498 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
2 TRCN0000323174 CCAAGTGTGGTTCCTATTTAT pLKO_005 5829 3UTR 100% 15.000 10.500 N CDK5RAP2 n/a
3 TRCN0000323172 GCGTTTAGAAGAATCTATTAA pLKO_005 4306 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
4 TRCN0000350811 TCAGGAGTGAAGGCTTAATAA pLKO_005 1734 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
5 TRCN0000350756 ATAGTCTAAAGAGGGATAAAG pLKO_005 1116 CDS 100% 13.200 9.240 N CDK5RAP2 n/a
6 TRCN0000128676 CGCTCTCTGATTATGAAACAT pLKO.1 4158 CDS 100% 5.625 3.938 N CDK5RAP2 n/a
7 TRCN0000147465 CTTGCTGAAATGGACATTCAA pLKO.1 5327 CDS 100% 5.625 3.938 N CDK5RAP2 n/a
8 TRCN0000128955 GCACAATCAAGAGCAAGTGAT pLKO.1 1597 CDS 100% 4.950 3.465 N CDK5RAP2 n/a
9 TRCN0000129226 CGCATCTATTTCCTTGAGGAA pLKO.1 419 CDS 100% 2.640 1.848 N CDK5RAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.