Transcript: Human XM_006717464.2

PREDICTED: Homo sapiens FERM domain containing 4A (FRMD4A), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRMD4A (55691)
Length:
10915
CDS:
117..2282

Additional Resources:

NCBI RefSeq record:
XM_006717464.2
NBCI Gene record:
FRMD4A (55691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145502 GCAGAACTGAAGTTAGCTTAA pLKO.1 3948 3UTR 100% 10.800 7.560 N FRMD4A n/a
2 TRCN0000121701 CCCAAAGAAGATTCATGGATA pLKO.1 4466 3UTR 100% 4.950 3.465 N FRMD4A n/a
3 TRCN0000142828 CGTATCTGAATGCACTGAAGA pLKO.1 625 CDS 100% 4.950 3.465 N FRMD4A n/a
4 TRCN0000143497 GCTGATCATAGACGATGGAAA pLKO.1 719 CDS 100% 4.950 3.465 N FRMD4A n/a
5 TRCN0000142080 CTGGAACGAGAGTTTGCCATT pLKO.1 522 CDS 100% 4.050 2.835 N FRMD4A n/a
6 TRCN0000142482 GCACCACATTTGTGTGCAGAT pLKO.1 3604 3UTR 100% 4.050 2.835 N FRMD4A n/a
7 TRCN0000143342 GCCAAGAGGAAGACATTCTTT pLKO.1 2913 3UTR 100% 5.625 3.375 N FRMD4A n/a
8 TRCN0000141074 CGACTATGACAAGTCACCCAT pLKO.1 926 CDS 100% 2.640 1.584 N FRMD4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.