Transcript: Human XM_006717490.2

PREDICTED: Homo sapiens Scm like with four mbt domains 2 (SFMBT2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFMBT2 (57713)
Length:
7797
CDS:
474..2651

Additional Resources:

NCBI RefSeq record:
XM_006717490.2
NBCI Gene record:
SFMBT2 (57713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149620 GCAGATTATCACAAGCAGCAT pLKO.1 1113 CDS 100% 2.640 2.112 N SFMBT2 n/a
2 TRCN0000146511 CATCTGACCAAGTCGCAAATT pLKO.1 1819 CDS 100% 13.200 9.240 N SFMBT2 n/a
3 TRCN0000149533 GCTGAGAACAAACTCTGAGAT pLKO.1 3977 3UTR 100% 4.950 3.465 N SFMBT2 n/a
4 TRCN0000148663 CATCAAGTTATGCCACCAGAT pLKO.1 2588 CDS 100% 4.050 2.835 N SFMBT2 n/a
5 TRCN0000149672 GAGGTCATTGTTGATGTGGAA pLKO.1 1317 CDS 100% 2.640 1.848 N SFMBT2 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3485 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.