Transcript: Human XM_006717895.1

PREDICTED: Homo sapiens coiled-coil serine rich protein 2 (CCSER2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCSER2 (54462)
Length:
5833
CDS:
102..1583

Additional Resources:

NCBI RefSeq record:
XM_006717895.1
NBCI Gene record:
CCSER2 (54462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426136 GCTCAAGAGCCTTATCATTTG pLKO_005 1038 CDS 100% 10.800 7.560 N CCSER2 n/a
2 TRCN0000062105 GCATGATATTCAACTGTCATT pLKO.1 524 CDS 100% 4.950 3.465 N CCSER2 n/a
3 TRCN0000062104 GCTCAGAAGATGTTTGTTGAT pLKO.1 375 CDS 100% 4.950 3.465 N CCSER2 n/a
4 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2907 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
5 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2980 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.