Transcript: Human XM_006719263.2

PREDICTED: Homo sapiens coiled-coil domain containing 63 (CCDC63), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC63 (160762)
Length:
1920
CDS:
196..1815

Additional Resources:

NCBI RefSeq record:
XM_006719263.2
NBCI Gene record:
CCDC63 (160762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136350 GAGATTGAAGACCTACGATTT pLKO.1 736 CDS 100% 10.800 15.120 N CCDC63 n/a
2 TRCN0000138931 GACATCAACCTTCCGCAGTAT pLKO.1 1513 CDS 100% 4.950 6.930 N CCDC63 n/a
3 TRCN0000137699 GCAGAAGATTGCGAGTCAGTA pLKO.1 354 CDS 100% 4.950 6.930 N CCDC63 n/a
4 TRCN0000138833 GCAGAAATTGTCCCACGATGA pLKO.1 1296 CDS 100% 4.050 5.670 N CCDC63 n/a
5 TRCN0000135849 CTAAACCAGCTCATTGAAGAT pLKO.1 1150 CDS 100% 4.950 3.465 N CCDC63 n/a
6 TRCN0000138107 GTTCCGAAACCAGCAGAAGAT pLKO.1 342 CDS 100% 4.950 3.465 N CCDC63 n/a
7 TRCN0000138512 CTCTCAGTACAACCTGGAGAT pLKO.1 921 CDS 100% 4.050 2.835 N CCDC63 n/a
8 TRCN0000138012 GCTCCAAACTAAGGAGGACTA pLKO.1 492 CDS 100% 4.050 2.835 N CCDC63 n/a
9 TRCN0000138389 CAGCAGAAATTGTCCCACGAT pLKO.1 1294 CDS 100% 2.640 1.848 N CCDC63 n/a
10 TRCN0000136471 CGACAATTATATCCTGAAGGA pLKO.1 1870 3UTR 100% 2.640 1.848 N CCDC63 n/a
11 TRCN0000138390 CGTCAAGCTGAATGATCGCAA pLKO.1 996 CDS 100% 2.640 1.848 N CCDC63 n/a
12 TRCN0000138373 CAAGGAGATCAAGACCCTGAA pLKO.1 375 CDS 100% 4.050 2.430 N CCDC63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.