Transcript: Human XM_006719367.4

PREDICTED: Homo sapiens acetyl-CoA carboxylase beta (ACACB), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACACB (32)
Length:
8607
CDS:
247..7017

Additional Resources:

NCBI RefSeq record:
XM_006719367.4
NBCI Gene record:
ACACB (32)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314942 CCGAATTACCATCGGCAATAA pLKO_005 2271 CDS 100% 13.200 18.480 N ACACB n/a
2 TRCN0000314941 TGTCCATCCGAGGCGACTTTA pLKO_005 1811 CDS 100% 13.200 18.480 N ACACB n/a
3 TRCN0000003096 GACGGCCTTAGACAATACAAA pLKO.1 6178 CDS 100% 5.625 7.875 N ACACB n/a
4 TRCN0000029031 CCGACGAATCACATTCTTGAT pLKO.1 4014 CDS 100% 4.950 6.930 N ACACB n/a
5 TRCN0000003093 ACCTCGTAGATGTGGAATTAA pLKO.1 2072 CDS 100% 15.000 10.500 N ACACB n/a
6 TRCN0000029032 CCCGAGAACCTCAAGAAATTA pLKO.1 3418 CDS 100% 15.000 10.500 N ACACB n/a
7 TRCN0000315011 AGCACGGGATGCTGATCAATA pLKO_005 4700 CDS 100% 13.200 9.240 N ACACB n/a
8 TRCN0000315010 TTGGATACCACATCGTGAAAT pLKO_005 7361 3UTR 100% 13.200 9.240 N ACACB n/a
9 TRCN0000029033 CCGCTGTGCATAGAAATGTAT pLKO.1 6277 CDS 100% 5.625 3.938 N ACACB n/a
10 TRCN0000029029 CGGCAGTTTCAAGGAAATCAT pLKO.1 5844 CDS 100% 5.625 3.938 N ACACB n/a
11 TRCN0000010759 GTGGAGCTGATTGTGGACATT pLKO.1 634 CDS 100% 4.950 3.465 N ACACB n/a
12 TRCN0000350403 GTGGAGCTGATTGTGGACATT pLKO_005 634 CDS 100% 4.950 3.465 N ACACB n/a
13 TRCN0000029030 GCTGAGTTTGTCACACGCTTT pLKO.1 382 CDS 100% 4.050 2.835 N ACACB n/a
14 TRCN0000003094 CATCCTGACATACACTGAATT pLKO.1 4863 CDS 100% 0.000 0.000 N ACACB n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7793 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7793 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.