Transcript: Human XM_006719782.3

PREDICTED: Homo sapiens MYC binding protein 2 (MYCBP2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYCBP2 (23077)
Length:
15363
CDS:
324..14642

Additional Resources:

NCBI RefSeq record:
XM_006719782.3
NBCI Gene record:
MYCBP2 (23077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330581 AGTGAAGGAAGCTCGATATAT pLKO_005 7415 CDS 100% 15.000 21.000 N MYCBP2 n/a
2 TRCN0000330582 ATTATGCAAGGATGGATTATA pLKO_005 1457 CDS 100% 15.000 21.000 N MYCBP2 n/a
3 TRCN0000330644 GAGAGTGAGCACCCGTATAAA pLKO_005 6393 CDS 100% 15.000 21.000 N MYCBP2 n/a
4 TRCN0000330645 GTGTTAGGACAGCATATAAAT pLKO_005 15123 3UTR 100% 15.000 21.000 N MYCBP2 n/a
5 TRCN0000330643 AGCTAGTGCTAACCGATTTAC pLKO_005 5489 CDS 100% 13.200 18.480 N MYCBP2 n/a
6 TRCN0000034289 GCGTGTCTATACCTGTGAAAT pLKO.1 4733 CDS 100% 13.200 18.480 N MYCBP2 n/a
7 TRCN0000034291 CGTCTCTAACACCTGTGGATT pLKO.1 5387 CDS 100% 4.950 6.930 N MYCBP2 n/a
8 TRCN0000034292 CCAAAGAACATGCTCCTATAA pLKO.1 9790 CDS 100% 13.200 10.560 N MYCBP2 n/a
9 TRCN0000034290 GCTCATATTGTCCAAGCTATT pLKO.1 12516 CDS 100% 10.800 7.560 N MYCBP2 n/a
10 TRCN0000034293 GCTATCAAGATGACAATCTAT pLKO.1 10828 CDS 100% 5.625 3.938 N MYCBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.