Transcript: Human XM_006720011.3

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 21 (PTPN21), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN21 (11099)
Length:
5881
CDS:
543..3698

Additional Resources:

NCBI RefSeq record:
XM_006720011.3
NBCI Gene record:
PTPN21 (11099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368363 CCACCGCAGTTGCACTATAAT pLKO_005 1197 CDS 100% 15.000 21.000 N PTPN21 n/a
2 TRCN0000220135 GCGCTTGCCTAACTCATACTT pLKO.1 3756 3UTR 100% 5.625 7.875 N PTPN21 n/a
3 TRCN0000220138 CAACGAATGATGAAAGGTGTA pLKO.1 2806 CDS 100% 4.050 5.670 N PTPN21 n/a
4 TRCN0000220137 GACGCCATACAAATAGCACAA pLKO.1 3436 CDS 100% 4.050 3.240 N PTPN21 n/a
5 TRCN0000220136 CAGCACCAACTCCTTAAATAA pLKO.1 1367 CDS 100% 15.000 10.500 N PTPN21 n/a
6 TRCN0000355659 GATATGAGTTGCTCCTATATA pLKO_005 4154 3UTR 100% 15.000 10.500 N PTPN21 n/a
7 TRCN0000220139 GTGGCCTTACTACATCAGAAA pLKO.1 735 CDS 100% 4.950 3.465 N PTPN21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.