Transcript: Human XM_006720902.4

PREDICTED: Homo sapiens periplakin (PPL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPL (5493)
Length:
6202
CDS:
16..5325

Additional Resources:

NCBI RefSeq record:
XM_006720902.4
NBCI Gene record:
PPL (5493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116938 CGCCAAGTTCACTGAAGTTTA pLKO.1 2583 CDS 100% 13.200 18.480 N PPL n/a
2 TRCN0000116937 CGGCACCTACAGAGAATGTTT pLKO.1 5941 3UTR 100% 5.625 4.500 N PPL n/a
3 TRCN0000116940 GCCGCCAAGTTCACTGAAGTT pLKO.1 2581 CDS 100% 4.950 3.960 N PPL n/a
4 TRCN0000423154 GCAGTACCAGCAAGCTGTAAA pLKO_005 2430 CDS 100% 13.200 9.240 N PPL n/a
5 TRCN0000437452 GGAGGACACCAACCGGAAATA pLKO_005 1824 CDS 100% 13.200 9.240 N PPL n/a
6 TRCN0000116939 CCGCTATGTCAACAAGGATAT pLKO.1 5262 CDS 100% 10.800 7.560 N PPL n/a
7 TRCN0000116941 GAGGTGACTAAGGAAGTCATT pLKO.1 3742 CDS 100% 0.495 0.347 N PPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.