Transcript: Human XM_006721286.3

PREDICTED: Homo sapiens solute carrier family 7 member 5 (SLC7A5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC7A5 (8140)
Length:
4187
CDS:
181..1239

Additional Resources:

NCBI RefSeq record:
XM_006721286.3
NBCI Gene record:
SLC7A5 (8140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043009 CTAGATCCCAACTTCTCATTT pLKO.1 394 CDS 100% 13.200 9.240 N SLC7A5 n/a
2 TRCN0000333467 CTAGATCCCAACTTCTCATTT pLKO_005 394 CDS 100% 13.200 9.240 N SLC7A5 n/a
3 TRCN0000043008 GCATTATACAGCGGCCTCTTT pLKO.1 451 CDS 100% 4.950 3.465 N SLC7A5 n/a
4 TRCN0000333529 GCATTATACAGCGGCCTCTTT pLKO_005 451 CDS 100% 4.950 3.465 N SLC7A5 n/a
5 TRCN0000043011 CGTCCTGTGTCAGAAGCTCAT pLKO.1 1194 CDS 100% 4.050 2.835 N SLC7A5 n/a
6 TRCN0000043010 GCCGTGGACTTCGGGAACTAT pLKO.1 649 CDS 100% 1.875 1.313 N SLC7A5 n/a
7 TRCN0000333531 GCCGTGGACTTCGGGAACTAT pLKO_005 649 CDS 100% 1.875 1.313 N SLC7A5 n/a
8 TRCN0000043012 GAATTTCGTCACAGAGGAAAT pLKO.1 495 CDS 100% 1.080 0.648 N SLC7A5 n/a
9 TRCN0000333530 GAATTTCGTCACAGAGGAAAT pLKO_005 495 CDS 100% 1.080 0.648 N SLC7A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.