Transcript: Human XM_006721807.3

PREDICTED: Homo sapiens tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 (TANC2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TANC2 (26115)
Length:
12196
CDS:
251..6445

Additional Resources:

NCBI RefSeq record:
XM_006721807.3
NBCI Gene record:
TANC2 (26115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239362 GTAGTTAAGCCTGGATTATTA pLKO_005 9795 3UTR 100% 15.000 21.000 N TANC2 n/a
2 TRCN0000238080 ATTTGCTGGAGGACGATTATT pLKO_005 6210 CDS 100% 15.000 12.000 N Tanc2 n/a
3 TRCN0000239363 ATTTGCTGGAGGACGATTATT pLKO_005 6210 CDS 100% 15.000 12.000 N TANC2 n/a
4 TRCN0000239365 TCCATGGCACTGGCGTCTTTA pLKO_005 3017 CDS 100% 13.200 10.560 N TANC2 n/a
5 TRCN0000239366 GCCAGCAGCAAGGAGTATTTA pLKO_005 3408 CDS 100% 15.000 10.500 N TANC2 n/a
6 TRCN0000239364 ACGGGCCAAGGTGGATCATTT pLKO_005 3292 CDS 100% 13.200 9.240 N TANC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.