Transcript: Human XM_006721963.2

PREDICTED: Homo sapiens transmembrane protein 104 (TMEM104), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM104 (54868)
Length:
4698
CDS:
145..1632

Additional Resources:

NCBI RefSeq record:
XM_006721963.2
NBCI Gene record:
TMEM104 (54868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138971 CTCTGATGAGATGGATCGCTT pLKO.1 854 CDS 100% 2.640 3.696 N TMEM104 n/a
2 TRCN0000122710 CCGGGTGGAAATGGGACAAAT pLKO.1 528 CDS 100% 13.200 9.240 N TMEM104 n/a
3 TRCN0000139575 CCTGCGTCCTTGTCTAAGAAA pLKO.1 2044 3UTR 100% 5.625 3.938 N TMEM104 n/a
4 TRCN0000121699 CTTGTTCTATTTCTGCATCAT pLKO.1 582 CDS 100% 4.950 3.465 N TMEM104 n/a
5 TRCN0000144629 GACAAGAACAAGAAGTGCTAA pLKO.1 2211 3UTR 100% 4.950 3.465 N TMEM104 n/a
6 TRCN0000142898 CCTCAGTGTTTCTCATAGCTT pLKO.1 3149 3UTR 100% 3.000 2.100 N TMEM104 n/a
7 TRCN0000139959 GACCTCTCTGATGAGATGGAT pLKO.1 849 CDS 100% 3.000 2.100 N TMEM104 n/a
8 TRCN0000140057 CCAATATCATCCTCAGCGAGA pLKO.1 1601 CDS 100% 2.160 1.512 N TMEM104 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.