Transcript: Human XM_006722619.2

PREDICTED: Homo sapiens ribonuclease H2 subunit A (RNASEH2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNASEH2A (10535)
Length:
1324
CDS:
378..1145

Additional Resources:

NCBI RefSeq record:
XM_006722619.2
NBCI Gene record:
RNASEH2A (10535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293582 CCGTTCTTCCCACCGATATTT pLKO_005 1088 CDS 100% 15.000 21.000 N RNASEH2A n/a
2 TRCN0000049863 GCGGGTCAAATACAACCTGAA pLKO.1 566 CDS 100% 4.050 5.670 N RNASEH2A n/a
3 TRCN0000049867 CATGGTCTACGCCATCTGTTA pLKO.1 377 5UTR 100% 4.950 3.960 N RNASEH2A n/a
4 TRCN0000318965 CATGGTCTACGCCATCTGTTA pLKO_005 377 5UTR 100% 4.950 3.960 N RNASEH2A n/a
5 TRCN0000293638 AGGACTTGGATACTGATTATG pLKO_005 844 CDS 100% 13.200 9.240 N RNASEH2A n/a
6 TRCN0000049864 ACATCCTACTTCCTCAATGAA pLKO.1 1050 CDS 100% 5.625 3.938 N RNASEH2A n/a
7 TRCN0000049865 CGCTGAAAGTGGCAGACTCAA pLKO.1 430 CDS 100% 4.950 3.465 N RNASEH2A n/a
8 TRCN0000049866 GAAATGGCAGTTCGTGGAGAA pLKO.1 818 CDS 100% 4.050 2.835 N RNASEH2A n/a
9 TRCN0000318898 GAAATGGCAGTTCGTGGAGAA pLKO_005 818 CDS 100% 4.050 2.835 N RNASEH2A n/a
10 TRCN0000293581 TCTACGCGCTCTACCTGCTTC pLKO_005 1154 3UTR 100% 1.350 0.945 N RNASEH2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.