Transcript: Human XM_006722842.2

PREDICTED: Homo sapiens solute carrier family 1 member 6 (SLC1A6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC1A6 (6511)
Length:
2087
CDS:
231..1925

Additional Resources:

NCBI RefSeq record:
XM_006722842.2
NBCI Gene record:
SLC1A6 (6511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442766 GAGGCAACGAGAGTGCTATGT pLKO_005 1903 CDS 100% 4.950 6.930 N SLC1A6 n/a
2 TRCN0000043555 CTTCGCACAATGACCAACGTA pLKO.1 1737 CDS 100% 3.000 2.400 N SLC1A6 n/a
3 TRCN0000430836 ATGCTGGTGTTACCTCTCATT pLKO_005 534 CDS 100% 4.950 3.465 N SLC1A6 n/a
4 TRCN0000043556 CAGAAATATGTTTCCACCAAA pLKO.1 776 CDS 100% 4.950 3.465 N SLC1A6 n/a
5 TRCN0000043553 CCAGATCAAGTACTTCTCTTT pLKO.1 482 CDS 100% 4.950 3.465 N SLC1A6 n/a
6 TRCN0000414597 GGGCATCATTATCTGGTATGC pLKO_005 1151 CDS 100% 4.050 2.835 N SLC1A6 n/a
7 TRCN0000043557 CCTGGGTCAGATCACAACCAT pLKO.1 1571 CDS 100% 3.000 2.100 N SLC1A6 n/a
8 TRCN0000043554 CAGCCTCAATGAGGCTATTAT pLKO.1 1121 CDS 100% 1.500 1.050 N SLC1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.