Transcript: Human XM_006723016.3

PREDICTED: Homo sapiens Ras and Rab interactor like (RINL), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RINL (126432)
Length:
3109
CDS:
392..1810

Additional Resources:

NCBI RefSeq record:
XM_006723016.3
NBCI Gene record:
RINL (126432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160338 CACATGCTAACAAACCATATA pLKO.1 2610 3UTR 100% 13.200 18.480 N RINL n/a
2 TRCN0000161025 GCTGGACGTAGAGTTTCTTAT pLKO.1 1468 CDS 100% 13.200 18.480 N RINL n/a
3 TRCN0000161859 GAAGGTGCTTTCCATTGTGAA pLKO.1 541 CDS 100% 4.950 3.465 N RINL n/a
4 TRCN0000159236 CAAAGAATGTATCACATGCTA pLKO.1 2598 3UTR 100% 3.000 2.100 N RINL n/a
5 TRCN0000162232 CGTAGAGTTTCTTATGGAGCT pLKO.1 1474 CDS 100% 2.160 1.512 N RINL n/a
6 TRCN0000163219 GCTTTCCATTGTGAACCAGCT pLKO.1 547 CDS 100% 2.160 1.512 N RINL n/a
7 TRCN0000163218 GAGGTGTGCAGAGATGTCTAT pLKO.1 1343 CDS 100% 4.950 2.970 N RINL n/a
8 TRCN0000163681 GACCTTGAAGGAAAGGAGGAA pLKO.1 761 CDS 100% 2.640 1.584 N RINL n/a
9 TRCN0000164177 CAGCCTGACAAACATGGAGAA pLKO.1 2775 3UTR 100% 4.050 2.025 Y RINL n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2710 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.