Transcript: Human XM_006723223.3

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 10 (MAP3K10), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K10 (4294)
Length:
2101
CDS:
244..1818

Additional Resources:

NCBI RefSeq record:
XM_006723223.3
NBCI Gene record:
MAP3K10 (4294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010674 GCAGGATGTTCACTCTATTTA pLKO.1 1912 3UTR 100% 15.000 10.500 N MAP3K10 n/a
2 TRCN0000231513 GCAGGATGTTCACTCTATTTA pLKO_005 1912 3UTR 100% 15.000 10.500 N MAP3K10 n/a
3 TRCN0000231512 GCCCTCTGGCTTTGAGCATAA pLKO_005 381 CDS 100% 10.800 7.560 N MAP3K10 n/a
4 TRCN0000381458 GGCCTCTCCAACTCTGGATAA pLKO_005 414 CDS 100% 10.800 7.560 N MAP3K10 n/a
5 TRCN0000001989 GAAGCAAACAGTGGTCATCAA pLKO.1 698 CDS 100% 4.950 3.465 N MAP3K10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.