Transcript: Human XM_006723699.3

PREDICTED: Homo sapiens GATA binding protein 5 (GATA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GATA5 (140628)
Length:
2615
CDS:
83..1276

Additional Resources:

NCBI RefSeq record:
XM_006723699.3
NBCI Gene record:
GATA5 (140628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017100 GAAGCCAAAGACCATCGCCAA pLKO.1 958 CDS 100% 2.160 3.024 N GATA5 n/a
2 TRCN0000017099 GCCGCTCGTTCGGCCTCAGAA pLKO.1 754 CDS 100% 0.000 0.000 N GATA5 n/a
3 TRCN0000433654 TCATTGCCCACATGGATAGAC pLKO_005 1772 3UTR 100% 4.950 3.960 N GATA5 n/a
4 TRCN0000431556 ACCACCACCACCAACTTGAAT pLKO_005 1580 3UTR 100% 5.625 3.938 N GATA5 n/a
5 TRCN0000437648 CTCAGGATCCACAAGGAATGC pLKO_005 991 CDS 100% 4.050 2.835 N GATA5 n/a
6 TRCN0000017101 CGGCCACTTGGAGTTCAAGTT pLKO.1 1153 CDS 100% 0.495 0.347 N GATA5 n/a
7 TRCN0000017102 GCCCACCTTCGTGTCCGACTT pLKO.1 595 CDS 100% 0.000 0.000 N GATA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.