Transcript: Human XM_006723776.2

PREDICTED: Homo sapiens glucocorticoid modulatory element binding protein 2 (GMEB2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GMEB2 (26205)
Length:
3935
CDS:
90..1448

Additional Resources:

NCBI RefSeq record:
XM_006723776.2
NBCI Gene record:
GMEB2 (26205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232267 AGCTCAAGGAAGCCGTGTTAG pLKO_005 69 5UTR 100% 10.800 15.120 N GMEB2 n/a
2 TRCN0000232268 TTGTGTGTCCCGGCATCAATG pLKO_005 178 CDS 100% 10.800 15.120 N GMEB2 n/a
3 TRCN0000232271 TCTAGGAAGAGTCAGATTTAT pLKO_005 2173 3UTR 100% 15.000 10.500 N GMEB2 n/a
4 TRCN0000016988 CCATTGGAGATGACACATTTA pLKO.1 538 CDS 100% 13.200 9.240 N GMEB2 n/a
5 TRCN0000232270 GCCATTGGAGATGACACATTT pLKO_005 537 CDS 100% 13.200 9.240 N GMEB2 n/a
6 TRCN0000232269 TCAGTACGACGAGCATGTAAT pLKO_005 209 CDS 100% 13.200 9.240 N GMEB2 n/a
7 TRCN0000016990 CAACCTCATCTGGAGGAAGTT pLKO.1 158 CDS 100% 4.950 3.465 N GMEB2 n/a
8 TRCN0000016991 CAGCTTCGAGATGCTGTACTT pLKO.1 675 CDS 100% 4.950 3.465 N GMEB2 n/a
9 TRCN0000016992 GTTCAGTACGACGAGCATGTA pLKO.1 207 CDS 100% 4.950 3.465 N GMEB2 n/a
10 TRCN0000424347 TTCCATCTGTTGCTTATTAAT pLKO_005 1693 3UTR 100% 15.000 9.000 N Gmeb2 n/a
11 TRCN0000016989 GAAGATAACATGGAGACAGAA pLKO.1 5 5UTR 100% 4.950 2.970 N GMEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.