Transcript: Human XM_006724066.2

PREDICTED: Homo sapiens PAX3 and PAX7 binding protein 1 (PAXBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAXBP1 (94104)
Length:
3867
CDS:
168..2816

Additional Resources:

NCBI RefSeq record:
XM_006724066.2
NBCI Gene record:
PAXBP1 (94104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235392 GGTATTGGTGAACGGTATAAA pLKO_005 1473 CDS 100% 15.000 21.000 N PAXBP1 n/a
2 TRCN0000244536 GGTATTGGTGAACGGTATAAA pLKO_005 1473 CDS 100% 15.000 21.000 N Paxbp1 n/a
3 TRCN0000235395 GTACACTTAGCGGATACAATT pLKO_005 2631 CDS 100% 13.200 10.560 N PAXBP1 n/a
4 TRCN0000235393 TATGGCATTCCTTATAGTTAT pLKO_005 1218 CDS 100% 13.200 10.560 N PAXBP1 n/a
5 TRCN0000235394 ACGATGTGTGCAGTGTAAATT pLKO_005 3099 3UTR 100% 15.000 10.500 N PAXBP1 n/a
6 TRCN0000000179 CTATTTGCTTGATTACCATTC pLKO.1 2836 3UTR 100% 6.000 4.200 N PAXBP1 n/a
7 TRCN0000000182 GTGATGATGATGCTTTAGTAA pLKO.1 1051 CDS 100% 5.625 3.938 N PAXBP1 n/a
8 TRCN0000000181 CCAGAACACTTACCAGACAAT pLKO.1 1181 CDS 100% 4.950 3.465 N PAXBP1 n/a
9 TRCN0000185948 CCGTTACTATTGATTTGGTAA pLKO.1 1321 CDS 100% 4.950 3.465 N Paxbp1 n/a
10 TRCN0000000180 GATGATGTATTTATGCCCTTA pLKO.1 2403 CDS 100% 4.050 2.835 N PAXBP1 n/a
11 TRCN0000000183 TCCATGAAAGAATTGCACAAA pLKO.1 1368 CDS 100% 4.950 2.970 N PAXBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.