Transcript: Human XM_006724247.4

PREDICTED: Homo sapiens ARVCF delta catenin family member (ARVCF), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARVCF (421)
Length:
3679
CDS:
120..2819

Additional Resources:

NCBI RefSeq record:
XM_006724247.4
NBCI Gene record:
ARVCF (421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123312 CGTGGTACCTTGCAGAAAGAT pLKO.1 2436 CDS 100% 0.000 0.000 N ARVCF n/a
2 TRCN0000437158 GTGAGATGGACCGGAACTTTG pLKO_005 1831 CDS 100% 10.800 7.560 N ARVCF n/a
3 TRCN0000444220 TAAGCCTCAGCCCGTTGATTC pLKO_005 2789 CDS 100% 10.800 7.560 N ARVCF n/a
4 TRCN0000123310 CGAGTGGACAACTGTCTTCAA pLKO.1 1469 CDS 100% 4.950 3.465 N ARVCF n/a
5 TRCN0000123313 GTGGACAACTGTCTTCAAGAA pLKO.1 1472 CDS 100% 4.950 3.465 N ARVCF n/a
6 TRCN0000123309 GCTGGGAAAGAACTTGGACTT pLKO.1 3243 3UTR 100% 4.050 2.835 N ARVCF n/a
7 TRCN0000123311 GTGTCTATTGTCACATCCGAA pLKO.1 249 CDS 100% 2.640 1.848 N ARVCF n/a
8 TRCN0000219442 TGTCCTACCACGTGCACAAAG pLKO.1 1663 CDS 100% 10.800 7.560 N Arvcf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.