Transcript: Human XM_006724763.1

PREDICTED: Homo sapiens SAM and SH3 domain containing 3 (SASH3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SASH3 (54440)
Length:
2811
CDS:
150..1442

Additional Resources:

NCBI RefSeq record:
XM_006724763.1
NBCI Gene record:
SASH3 (54440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062585 GATGTGATCCAGATCATTGAA pLKO.1 897 CDS 100% 5.625 4.500 N SASH3 n/a
2 TRCN0000414246 ATGACCACGACTCGCTGAAAC pLKO_005 715 CDS 100% 10.800 7.560 N SASH3 n/a
3 TRCN0000424129 GCTCTTTCAAATTCATCTATG pLKO_005 964 CDS 100% 10.800 7.560 N SASH3 n/a
4 TRCN0000062583 GACTTCAAAGAGCTGCGAGAA pLKO.1 1146 CDS 100% 4.050 2.835 N SASH3 n/a
5 TRCN0000062587 GCTGCGAGAAACACACCTCAA pLKO.1 1157 CDS 100% 4.050 2.835 N SASH3 n/a
6 TRCN0000062584 GAGAAGGAGTTTAATCTGGAT pLKO.1 276 CDS 100% 2.640 1.848 N SASH3 n/a
7 TRCN0000062586 TCTGAGCAAGAGGAGCATGAA pLKO.1 540 CDS 100% 4.950 2.970 N SASH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.