Transcript: Mouse XM_011238338.2

PREDICTED: Mus musculus RB1-inducible coiled-coil 1 (Rb1cc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rb1cc1 (12421)
Length:
7164
CDS:
245..5065

Additional Resources:

NCBI RefSeq record:
XM_011238338.2
NBCI Gene record:
Rb1cc1 (12421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310918 TAGATGAGCGGCACGACAATT pLKO_005 4812 CDS 100% 13.200 18.480 N Rb1cc1 n/a
2 TRCN0000304383 GATAATGCATACTCAACATTG pLKO_005 3058 CDS 100% 10.800 15.120 N Rb1cc1 n/a
3 TRCN0000084985 CCCAAAGATTATTCAACCATT pLKO.1 1249 CDS 100% 4.950 6.930 N Rb1cc1 n/a
4 TRCN0000304384 ATTGCATGCAGATAATCATAA pLKO_005 5539 3UTR 100% 13.200 10.560 N Rb1cc1 n/a
5 TRCN0000084986 GCTGAATTTCAGTGCTTAGAA pLKO.1 3164 CDS 100% 5.625 4.500 N Rb1cc1 n/a
6 TRCN0000084987 CCAACTTTAACACAGTCTTAA pLKO.1 4221 CDS 100% 13.200 9.240 N Rb1cc1 n/a
7 TRCN0000331566 CCAACTTTAACACAGTCTTAA pLKO_005 4221 CDS 100% 13.200 9.240 N Rb1cc1 n/a
8 TRCN0000084983 CCACCCAAATAACTAGAAATT pLKO.1 5311 3UTR 100% 13.200 9.240 N Rb1cc1 n/a
9 TRCN0000084984 CGCCTTGTAATAGAGCTGTTA pLKO.1 1661 CDS 100% 4.950 3.465 N Rb1cc1 n/a
10 TRCN0000301727 CGCCTTGTAATAGAGCTGTTA pLKO_005 1661 CDS 100% 4.950 3.465 N Rb1cc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.