Transcript: Mouse XM_011238441.2

PREDICTED: Mus musculus inositol polyphosphate-1-phosphatase (Inpp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Inpp1 (16329)
Length:
5557
CDS:
124..1314

Additional Resources:

NCBI RefSeq record:
XM_011238441.2
NBCI Gene record:
Inpp1 (16329)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314049 TTCATGAGGACGTGGACTTAA pLKO_005 497 CDS 100% 13.200 18.480 N Inpp1 n/a
2 TRCN0000314099 TTGATTCAACCTATCAGTATA pLKO_005 587 CDS 100% 13.200 18.480 N Inpp1 n/a
3 TRCN0000080960 GCCAATGTTAAATCCAACCAA pLKO.1 619 CDS 100% 3.000 2.400 N Inpp1 n/a
4 TRCN0000317893 GCCAATGTTAAATCCAACCAA pLKO_005 619 CDS 100% 3.000 2.400 N Inpp1 n/a
5 TRCN0000080961 CTCACGAGAGTCTTGGGATTT pLKO.1 554 CDS 100% 10.800 7.560 N Inpp1 n/a
6 TRCN0000350744 GCTTCTCAGCAAGGTCCTTAA pLKO_005 438 CDS 100% 10.800 7.560 N Inpp1 n/a
7 TRCN0000314100 CCTTCAGCCGAACTGCATCTT pLKO_005 1330 3UTR 100% 4.950 3.465 N Inpp1 n/a
8 TRCN0000080962 GTAGACATGAAAGAGTGCTTA pLKO.1 1108 CDS 100% 4.950 3.465 N Inpp1 n/a
9 TRCN0000080958 TCCTGTTATCTCTTGAAGATA pLKO.1 1352 3UTR 100% 0.563 0.394 N Inpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.