Transcript: Mouse XM_011238695.2

PREDICTED: Mus musculus sphingosine-1-phosphate phosphotase 2 (Sgpp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgpp2 (433323)
Length:
4135
CDS:
104..742

Additional Resources:

NCBI RefSeq record:
XM_011238695.2
NBCI Gene record:
Sgpp2 (433323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080801 CCGTTCCTCTTGTGCTACAAT pLKO.1 841 3UTR 100% 5.625 7.875 N Sgpp2 n/a
2 TRCN0000080800 CCCTGCAAGTATTATTCTCAT pLKO.1 1109 3UTR 100% 4.950 3.960 N Sgpp2 n/a
3 TRCN0000051787 GAAGTGTTCTACATCACGTTT pLKO.1 263 CDS 100% 4.950 3.960 N SGPP2 n/a
4 TRCN0000080799 CCCTAATTTGTCCAGAAGATT pLKO.1 310 CDS 100% 5.625 3.938 N Sgpp2 n/a
5 TRCN0000080802 AGATTGGTTGTGATATGGGTT pLKO.1 326 CDS 100% 2.640 1.848 N Sgpp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.