Transcript: Mouse XM_011238881.2

PREDICTED: Mus musculus serologically defined colon cancer antigen 8 (Sdccag8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sdccag8 (76816)
Length:
2804
CDS:
203..2398

Additional Resources:

NCBI RefSeq record:
XM_011238881.2
NBCI Gene record:
Sdccag8 (76816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250551 ATGCGCTTTCAGTTGAATAAA pLKO_005 1583 CDS 100% 15.000 21.000 N Sdccag8 n/a
2 TRCN0000250549 ATCGCAAATAGTTCGACTTAG pLKO_005 2095 CDS 100% 10.800 15.120 N Sdccag8 n/a
3 TRCN0000250550 CCATCGAGAGGCTGACTAAAG pLKO_005 1125 CDS 100% 10.800 15.120 N Sdccag8 n/a
4 TRCN0000250547 ACAACCTCGTTCCTATCATTA pLKO_005 549 CDS 100% 13.200 10.560 N Sdccag8 n/a
5 TRCN0000200066 CGAGAAGATTCTAGGGTGGAT pLKO.1 779 CDS 100% 2.640 2.112 N Sdccag8 n/a
6 TRCN0000217096 CCACTGGTGATGCCAATAAAT pLKO.1 855 CDS 100% 15.000 10.500 N Sdccag8 n/a
7 TRCN0000216608 GAGGAAAGACTTAGCTGAATA pLKO.1 952 CDS 100% 13.200 9.240 N Sdccag8 n/a
8 TRCN0000250548 TCATCTGATTTGTACTTAATG pLKO_005 2561 3UTR 100% 13.200 9.240 N Sdccag8 n/a
9 TRCN0000177945 GCAGTTGCTTAACAAGCAGAA pLKO.1 2275 CDS 100% 4.050 2.835 N Sdccag8 n/a
10 TRCN0000217164 CTGGATGAAACAGAGTGAAAT pLKO.1 2513 3UTR 100% 13.200 7.920 N Sdccag8 n/a
11 TRCN0000415404 AGAGATATTTACATTCATCTG pLKO_005 2547 3UTR 100% 4.050 2.430 N SDCCAG8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.