Transcript: Mouse XM_011238976.2

PREDICTED: Mus musculus proline and serine rich 2 (Proser2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Proser2 (227545)
Length:
3796
CDS:
538..1953

Additional Resources:

NCBI RefSeq record:
XM_011238976.2
NBCI Gene record:
Proser2 (227545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263426 CCCGAAGATGTCATCGATTTA pLKO_005 847 CDS 100% 13.200 18.480 N Proser2 n/a
2 TRCN0000263429 AGGACGTTATCCTGTTCTTTG pLKO_005 713 CDS 100% 10.800 15.120 N Proser2 n/a
3 TRCN0000263427 TATGCTCTGTTCCCAATTAAA pLKO_005 2784 3UTR 100% 15.000 12.000 N Proser2 n/a
4 TRCN0000263428 ACTCTTGATTCCCTGGAATAT pLKO_005 739 CDS 100% 13.200 10.560 N Proser2 n/a
5 TRCN0000282626 CGGTCCAGAAGTTTCACTATG pLKO_005 655 CDS 100% 10.800 8.640 N Proser2 n/a
6 TRCN0000217703 GTATCGTGAGTCTTCGTATAC pLKO.1 2594 3UTR 100% 10.800 8.640 N Proser2 n/a
7 TRCN0000179909 CAAGGACTTCAACAAGACCAT pLKO.1 1362 CDS 100% 2.640 1.848 N Proser2 n/a
8 TRCN0000184161 CAGCAACATAAGCGTGACCAA pLKO.1 1332 CDS 100% 2.640 1.848 N Proser2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.