Transcript: Mouse XM_011239048.2

PREDICTED: Mus musculus surfeit gene 1 (Surf1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Surf1 (20930)
Length:
954
CDS:
110..901

Additional Resources:

NCBI RefSeq record:
XM_011239048.2
NBCI Gene record:
Surf1 (20930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217501 GAGTCACCATCCTGGTTAATA pLKO.1 513 CDS 100% 15.000 12.000 N Surf1 n/a
2 TRCN0000249897 GAGTCACCATCCTGGTTAATA pLKO_005 513 CDS 100% 15.000 12.000 N Surf1 n/a
3 TRCN0000249899 GGCCACTTTGACCACTCTAAA pLKO_005 371 CDS 100% 13.200 10.560 N Surf1 n/a
4 TRCN0000249898 GAAAGGAATCACTGGTATTAT pLKO_005 665 CDS 100% 15.000 10.500 N Surf1 n/a
5 TRCN0000249900 GAAATGGAAGCTGAAACTTAT pLKO_005 253 CDS 100% 13.200 9.240 N Surf1 n/a
6 TRCN0000249901 TGGAAGCTATGGCCAAGATAA pLKO_005 693 CDS 100% 13.200 9.240 N Surf1 n/a
7 TRCN0000193247 CAGAAAGGAATCACTGGTATT pLKO.1 663 CDS 100% 10.800 7.560 N Surf1 n/a
8 TRCN0000176376 CGGAAATGGAAGCTGAAACTT pLKO.1 251 CDS 100% 5.625 3.938 N Surf1 n/a
9 TRCN0000173831 CGTCGGAAATGGAAGCTGAAA pLKO.1 248 CDS 100% 4.950 3.465 N Surf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.