Transcript: Mouse XM_011239113.2

PREDICTED: Mus musculus suppressor of cancer cell invasion (Scai), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scai (320271)
Length:
4227
CDS:
313..2010

Additional Resources:

NCBI RefSeq record:
XM_011239113.2
NBCI Gene record:
Scai (320271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242156 AGGTCAAATTCAGCGAATTAA pLKO_005 1049 CDS 100% 15.000 21.000 N Scai n/a
2 TRCN0000256982 CAGCTGTATTACCACTATTAT pLKO_005 583 CDS 100% 15.000 21.000 N Scai n/a
3 TRCN0000216616 GATTATACTCATCGCTTTAAT pLKO.1 820 CDS 100% 15.000 21.000 N Scai n/a
4 TRCN0000242158 TCCGATACTACGCAAGATTTA pLKO_005 725 CDS 100% 13.200 18.480 N Scai n/a
5 TRCN0000242159 CTACTCTACAAACCGACTTTC pLKO_005 1198 CDS 100% 10.800 8.640 N Scai n/a
6 TRCN0000191148 CCTGAGTTGGTTGTTAAGAAA pLKO.1 703 CDS 100% 5.625 4.500 N Scai n/a
7 TRCN0000191147 CATAAGTTACTCTCTGATGTA pLKO.1 2471 3UTR 100% 4.950 3.465 N Scai n/a
8 TRCN0000201029 CGGGACATTATCAATGGAGAT pLKO.1 1372 CDS 100% 4.050 2.835 N Scai n/a
9 TRCN0000162372 CACGTTCAATAGATCAGGCAT pLKO.1 1751 CDS 100% 2.640 3.696 N SCAI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.