Transcript: Mouse XM_011239261.2

PREDICTED: Mus musculus beaded filament structural protein 1, in lens-CP94 (Bfsp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bfsp1 (12075)
Length:
2083
CDS:
332..1945

Additional Resources:

NCBI RefSeq record:
XM_011239261.2
NBCI Gene record:
Bfsp1 (12075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090300 GACCGTTATCATCGGATCATT pLKO.1 848 CDS 100% 5.625 7.875 N Bfsp1 n/a
2 TRCN0000090301 AGACCGTTATCATCGGATCAT pLKO.1 847 CDS 100% 4.950 6.930 N Bfsp1 n/a
3 TRCN0000090302 CGGCTTAACAAGGAAGCCGAT pLKO.1 341 CDS 100% 0.216 0.173 N Bfsp1 n/a
4 TRCN0000441298 GGCCCTGGAACAAGCTATTAA pLKO_005 670 CDS 100% 15.000 10.500 N Bfsp1 n/a
5 TRCN0000427500 TATGAAGAGACTTCCGTAATT pLKO_005 1850 CDS 100% 13.200 9.240 N Bfsp1 n/a
6 TRCN0000421849 AGGGAAGGTGACCACTCAAAC pLKO_005 1526 CDS 100% 10.800 7.560 N Bfsp1 n/a
7 TRCN0000090299 GCAGGATATTACAGCAGCTAA pLKO.1 988 CDS 100% 4.950 3.465 N Bfsp1 n/a
8 TRCN0000416868 TGGAATCCATTGAGAAGATTT pLKO_005 1809 CDS 100% 13.200 7.920 N Bfsp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.