Transcript: Mouse XM_011239329.2

PREDICTED: Mus musculus cyclin D-type binding-protein 1 (Ccndbp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ccndbp1 (17151)
Length:
1308
CDS:
223..804

Additional Resources:

NCBI RefSeq record:
XM_011239329.2
NBCI Gene record:
Ccndbp1 (17151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077818 GCTAGGAGAGATTGCAGTTAT pLKO.1 1110 3UTR 100% 13.200 9.240 N Ccndbp1 n/a
2 TRCN0000334287 GCTAGGAGAGATTGCAGTTAT pLKO_005 1110 3UTR 100% 13.200 9.240 N Ccndbp1 n/a
3 TRCN0000077821 GTGACCTGATTTCCTGCAATA pLKO.1 137 5UTR 100% 10.800 7.560 N Ccndbp1 n/a
4 TRCN0000077822 CACTGAGAATGGTGACCTGAT pLKO.1 126 5UTR 100% 4.050 2.835 N Ccndbp1 n/a
5 TRCN0000334218 CACTGAGAATGGTGACCTGAT pLKO_005 126 5UTR 100% 4.050 2.835 N Ccndbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.