Transcript: Mouse XM_011239411.2

PREDICTED: Mus musculus transmembrane protein 87A (Tmem87a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem87a (211499)
Length:
2990
CDS:
552..1805

Additional Resources:

NCBI RefSeq record:
XM_011239411.2
NBCI Gene record:
Tmem87a (211499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246454 GCTCTCTTTGTACCGACATTT pLKO_005 1328 CDS 100% 13.200 18.480 N Tmem87a n/a
2 TRCN0000246450 GTGTATTGTGTACGTACTATT pLKO_005 833 CDS 100% 13.200 10.560 N Tmem87a n/a
3 TRCN0000246451 TTGGCAGTGGCAGCGTCTATT pLKO_005 1365 CDS 100% 13.200 10.560 N Tmem87a n/a
4 TRCN0000246453 GTGTCATTTACACCATAATTT pLKO_005 2138 3UTR 100% 15.000 10.500 N Tmem87a n/a
5 TRCN0000144956 GAACGAATGATCACACACTTT pLKO.1 1764 CDS 100% 4.950 3.465 N TMEM87A n/a
6 TRCN0000144308 CAATGCATGAACCATTGCAAA pLKO.1 640 CDS 100% 0.495 0.693 N TMEM87A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.