Transcript: Mouse XM_011239440.2

PREDICTED: Mus musculus ubiquitin protein ligase E3 component n-recognin 1 (Ubr1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubr1 (22222)
Length:
5568
CDS:
275..3244

Additional Resources:

NCBI RefSeq record:
XM_011239440.2
NBCI Gene record:
Ubr1 (22222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365849 TGCCAGAATATCGGGTTATAA pLKO_005 1699 CDS 100% 15.000 21.000 N Ubr1 n/a
2 TRCN0000365924 TTACCAGAGAGGAGGTTATAA pLKO_005 255 5UTR 100% 15.000 10.500 N Ubr1 n/a
3 TRCN0000365923 CATAACTGTCCTAGTTCATTT pLKO_005 3537 3UTR 100% 13.200 9.240 N Ubr1 n/a
4 TRCN0000374109 GATCACCTGTGATGGTCTAAA pLKO_005 3691 3UTR 100% 13.200 9.240 N Ubr1 n/a
5 TRCN0000040923 GCACCTTTGTATTTGGTGTTT pLKO.1 3629 3UTR 100% 4.950 3.465 N Ubr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.