Transcript: Mouse XM_011239472.2

PREDICTED: Mus musculus early B cell factor 4 (Ebf4), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ebf4 (228598)
Length:
1818
CDS:
292..1818

Additional Resources:

NCBI RefSeq record:
XM_011239472.2
NBCI Gene record:
Ebf4 (228598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424228 GACCTCTACGTGCGCCTTATT pLKO_005 667 CDS 100% 13.200 18.480 N Ebf4 n/a
2 TRCN0000081635 CGTCATTATCATCGGAGACAA pLKO.1 1110 CDS 100% 4.950 6.930 N Ebf4 n/a
3 TRCN0000427292 CGAAGCAGGCTATCATCTATG pLKO_005 698 CDS 100% 10.800 8.640 N Ebf4 n/a
4 TRCN0000081637 CTGGTGTATAATAATGGACTT pLKO.1 634 CDS 100% 4.050 3.240 N Ebf4 n/a
5 TRCN0000081636 CCTTCTGATCCAGTCATTATT pLKO.1 823 CDS 100% 15.000 10.500 N Ebf4 n/a
6 TRCN0000081634 CGCCTTCTGATCCAGTCATTA pLKO.1 821 CDS 100% 13.200 9.240 N Ebf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.