Transcript: Mouse XM_011239577.2

PREDICTED: Mus musculus solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 (Slc28a2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc28a2 (269346)
Length:
2459
CDS:
799..2379

Additional Resources:

NCBI RefSeq record:
XM_011239577.2
NBCI Gene record:
Slc28a2 (269346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079325 AGATGCTTGAAGCCTCTGGAA pLKO.1 1201 CDS 100% 2.640 1.848 N Slc28a2 n/a
2 TRCN0000079324 GCGGAAATCTTGAGCAAAGAT pLKO.1 884 CDS 100% 0.563 0.394 N Slc28a2 n/a
3 TRCN0000262710 TTCAGTCTCTGCCAATCATTA pLKO_005 1580 CDS 100% 13.200 6.600 Y Gm14085 n/a
4 TRCN0000282401 TTCGGATGTGTGATGTCTATT pLKO_005 1606 CDS 100% 13.200 6.600 Y Gm14085 n/a
5 TRCN0000262709 GAGTAGAAGAGTGGATCAATG pLKO_005 2330 CDS 100% 10.800 5.400 Y Gm14085 n/a
6 TRCN0000079327 TGCTGGTTTATTCAGAAAGAT pLKO.1 1023 CDS 100% 5.625 2.813 Y Slc28a2 n/a
7 TRCN0000079326 CCTGCTTGGTCTCTTGTGTTT pLKO.1 1044 CDS 100% 4.950 2.475 Y Slc28a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.