Transcript: Mouse XM_011239590.2

PREDICTED: Mus musculus MAX gene associated (Mga), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mga (29808)
Length:
14511
CDS:
549..9347

Additional Resources:

NCBI RefSeq record:
XM_011239590.2
NBCI Gene record:
Mga (29808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271143 TGTTGCCTCAGCCGGATTTAT pLKO_005 4096 CDS 100% 15.000 21.000 N Mga n/a
2 TRCN0000082084 CGAGTATATGAACGAAAGAAA pLKO.1 4257 CDS 100% 5.625 7.875 N Mga n/a
3 TRCN0000284332 TGCTAATCGAGATCCATTATT pLKO_005 3848 CDS 100% 15.000 12.000 N Mga n/a
4 TRCN0000082083 GCTCCGATCAAGAAGGGAATA pLKO.1 1375 CDS 100% 10.800 8.640 N Mga n/a
5 TRCN0000271190 GTGAGAGGGCATCGGTATAAA pLKO_005 8406 CDS 100% 15.000 10.500 N Mga n/a
6 TRCN0000271140 TAGATCCAGAGCCGGTTTATA pLKO_005 4036 CDS 100% 15.000 10.500 N Mga n/a
7 TRCN0000271211 TTACCCTTTCAGTCATAATTA pLKO_005 10043 3UTR 100% 15.000 10.500 N Mga n/a
8 TRCN0000082085 GCACAGGAATTTATACCTAAA pLKO.1 8370 CDS 100% 10.800 7.560 N Mga n/a
9 TRCN0000082086 CCTCAGATAATCAGGTGACTA pLKO.1 3376 CDS 100% 4.950 3.465 N Mga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.