Transcript: Mouse XM_011239592.1

PREDICTED: Mus musculus MAX gene associated (Mga), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mga (29808)
Length:
14219
CDS:
551..9055

Additional Resources:

NCBI RefSeq record:
XM_011239592.1
NBCI Gene record:
Mga (29808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271143 TGTTGCCTCAGCCGGATTTAT pLKO_005 4098 CDS 100% 15.000 21.000 N Mga n/a
2 TRCN0000082084 CGAGTATATGAACGAAAGAAA pLKO.1 4259 CDS 100% 5.625 7.875 N Mga n/a
3 TRCN0000284332 TGCTAATCGAGATCCATTATT pLKO_005 3850 CDS 100% 15.000 12.000 N Mga n/a
4 TRCN0000082083 GCTCCGATCAAGAAGGGAATA pLKO.1 1377 CDS 100% 10.800 8.640 N Mga n/a
5 TRCN0000271190 GTGAGAGGGCATCGGTATAAA pLKO_005 8114 CDS 100% 15.000 10.500 N Mga n/a
6 TRCN0000271140 TAGATCCAGAGCCGGTTTATA pLKO_005 4038 CDS 100% 15.000 10.500 N Mga n/a
7 TRCN0000271211 TTACCCTTTCAGTCATAATTA pLKO_005 9751 3UTR 100% 15.000 10.500 N Mga n/a
8 TRCN0000082085 GCACAGGAATTTATACCTAAA pLKO.1 8078 CDS 100% 10.800 7.560 N Mga n/a
9 TRCN0000082087 CCAAGATGATATGGCTGAGAA pLKO.1 4741 CDS 100% 4.950 3.465 N Mga n/a
10 TRCN0000082086 CCTCAGATAATCAGGTGACTA pLKO.1 3378 CDS 100% 4.950 3.465 N Mga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.