Transcript: Mouse XM_011239758.2

PREDICTED: Mus musculus ubiquitin protein ligase E3 component n-recognin 3 (Ubr3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubr3 (68795)
Length:
8344
CDS:
327..6005

Additional Resources:

NCBI RefSeq record:
XM_011239758.2
NBCI Gene record:
Ubr3 (68795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367315 TTCATTACTGCAGCGTTATTT pLKO_005 4214 CDS 100% 15.000 21.000 N Ubr3 n/a
2 TRCN0000367245 TACTTAAGAGAAGGCTATAAT pLKO_005 984 CDS 100% 15.000 10.500 N Ubr3 n/a
3 TRCN0000413730 TACTTAAGAGAAGGCTATAAT pLKO_005 984 CDS 100% 15.000 10.500 N UBR3 n/a
4 TRCN0000367246 CAATCCCTGGCCTCCGTATAA pLKO_005 3014 CDS 100% 13.200 9.240 N Ubr3 n/a
5 TRCN0000367248 GTCACGAGAAGTACCTTATAG pLKO_005 1198 CDS 100% 13.200 9.240 N Ubr3 n/a
6 TRCN0000191533 GCACCAAAGATCAATCCATAA pLKO.1 1420 CDS 100% 10.800 7.560 N Ubr3 n/a
7 TRCN0000190991 CCAGCAGAACTACAAAGACCT pLKO.1 1139 CDS 100% 2.640 1.848 N Ubr3 n/a
8 TRCN0000367247 CACCTCAGCATTGCATATATT pLKO_005 6010 3UTR 100% 15.000 9.000 N Ubr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.