Transcript: Mouse XM_011239777.3

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 6 (Chd6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Chd6 (71389)
Length:
10434
CDS:
50..8119

Additional Resources:

NCBI RefSeq record:
XM_011239777.3
NBCI Gene record:
Chd6 (71389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305501 CAAACTTCTGGAAGGGTTAAA pLKO_005 1804 CDS 100% 13.200 18.480 N Chd6 n/a
2 TRCN0000305502 CTCAACCGCACTGACTATTAC pLKO_005 4757 CDS 100% 13.200 18.480 N Chd6 n/a
3 TRCN0000358973 GATACACCTATGAGCGAATTG pLKO_005 2448 CDS 100% 10.800 15.120 N CHD6 n/a
4 TRCN0000096740 CCCGTGAGTATAGGAACAGTA pLKO.1 1335 CDS 100% 4.950 6.930 N Chd6 n/a
5 TRCN0000096741 CCTGGTATTGAGGCAGAAATT pLKO.1 5237 CDS 100% 13.200 10.560 N Chd6 n/a
6 TRCN0000096743 CGTGAAGGTATATCGCCTAAT pLKO.1 2683 CDS 100% 10.800 8.640 N Chd6 n/a
7 TRCN0000107416 GCACAGAAGATCAAGCGATTT pLKO.1 1013 CDS 100% 10.800 8.640 N CHD6 n/a
8 TRCN0000096742 GCCTCGAAATGAACTCCTAAA pLKO.1 7315 CDS 100% 10.800 8.640 N Chd6 n/a
9 TRCN0000309879 GCCTCGAAATGAACTCCTAAA pLKO_005 7315 CDS 100% 10.800 8.640 N Chd6 n/a
10 TRCN0000096739 CGGCTGTTAAATCCTAAAGAT pLKO.1 9817 3UTR 100% 5.625 4.500 N Chd6 n/a
11 TRCN0000309880 CGGCTGTTAAATCCTAAAGAT pLKO_005 9817 3UTR 100% 5.625 4.500 N Chd6 n/a
12 TRCN0000311332 CAGGCGTCTGGTCACTATTTA pLKO_005 4174 CDS 100% 15.000 10.500 N Chd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.