Transcript: Mouse XM_011239781.2

PREDICTED: Mus musculus zinc finger, FYVE domain containing 19 (Zfyve19), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfyve19 (72008)
Length:
1941
CDS:
411..1598

Additional Resources:

NCBI RefSeq record:
XM_011239781.2
NBCI Gene record:
Zfyve19 (72008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192829 GAGGGCCATGATAACTTTGAT pLKO.1 1521 CDS 100% 5.625 7.875 N Zfyve19 n/a
2 TRCN0000241292 CTGGAAGGAAGAAACATAATA pLKO_005 1746 3UTR 100% 15.000 10.500 N Zfyve19 n/a
3 TRCN0000241293 GGTCACCACCTCAGAACTATA pLKO_005 613 CDS 100% 13.200 9.240 N Zfyve19 n/a
4 TRCN0000241295 GGAGTATGGCTGTAAGAATTG pLKO_005 461 CDS 100% 10.800 7.560 N Zfyve19 n/a
5 TRCN0000241294 TGCAATGAGGATGCTACTTTG pLKO_005 1452 CDS 100% 10.800 7.560 N Zfyve19 n/a
6 TRCN0000192400 CAAGAAGGAGTATGGCTGTAA pLKO.1 455 CDS 100% 4.950 3.465 N Zfyve19 n/a
7 TRCN0000201220 GTATCTGCAATGAGGATGCTA pLKO.1 1447 CDS 100% 3.000 2.100 N Zfyve19 n/a
8 TRCN0000241296 CCATGATAACTTTGATCTTAA pLKO_005 1526 CDS 100% 13.200 7.920 N Zfyve19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.