Transcript: Mouse XM_011240004.1

PREDICTED: Mus musculus chloride channel accessory 3A1 (Clca3a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clca3a1 (12722)
Length:
4335
CDS:
1165..3420

Additional Resources:

NCBI RefSeq record:
XM_011240004.1
NBCI Gene record:
Clca3a1 (12722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069332 GCATGGATAAACGGTACAGTA pLKO.1 2212 CDS 100% 4.950 2.970 N Clca3a1 n/a
2 TRCN0000069330 GCCCTCATAGAAGCTGAACAT pLKO.1 2608 CDS 100% 4.950 2.970 N Clca3a1 n/a
3 TRCN0000069328 GCTGAGTTTATAGGTGATTAT pLKO.1 3007 CDS 100% 13.200 6.600 Y Clca3a1 n/a
4 TRCN0000069712 CCAGAAATCATTCTTCAAGAT pLKO.1 2293 CDS 100% 4.950 2.475 Y Clca3a2 n/a
5 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 3934 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
6 TRCN0000069329 GCCTCCATAATGTTCATGCAA pLKO.1 1414 CDS 100% 3.000 1.500 Y Clca3a1 n/a
7 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3895 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.