Transcript: Mouse XM_011240054.2

PREDICTED: Mus musculus ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (St6galnac3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St6galnac3 (20447)
Length:
804
CDS:
117..776

Additional Resources:

NCBI RefSeq record:
XM_011240054.2
NBCI Gene record:
St6galnac3 (20447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035368 GAACTCACTATGGATACATAA pLKO.1 322 CDS 100% 13.200 18.480 N ST6GALNAC3 n/a
2 TRCN0000453943 GAACTCACTATGGATACATAA pLKO_005 322 CDS 100% 13.200 18.480 N St6galnac3 n/a
3 TRCN0000093770 CGTGTCAAATTCAGGTCAAAT pLKO.1 392 CDS 100% 13.200 9.240 N St6galnac3 n/a
4 TRCN0000093771 GCCTTGTCAATGATGCGACTT pLKO.1 223 CDS 100% 4.050 2.835 N St6galnac3 n/a
5 TRCN0000453868 CATCGTGTACAACATGTTAAA pLKO_005 647 CDS 100% 13.200 7.920 N St6galnac3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.