Transcript: Mouse XM_011240065.1

PREDICTED: Mus musculus zinc finger, B-box domain containing (Zbbx), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zbbx (213234)
Length:
1615
CDS:
57..1547

Additional Resources:

NCBI RefSeq record:
XM_011240065.1
NBCI Gene record:
Zbbx (213234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241649 AGTTCTACATTTACGGATTAT pLKO_005 321 CDS 100% 13.200 10.560 N Zbbx n/a
2 TRCN0000215344 CTTCCCTTCATCAAGCATAAA pLKO.1 848 CDS 100% 13.200 9.240 N Zbbx n/a
3 TRCN0000216846 GGTATCACAAGGATGACATAA pLKO.1 439 CDS 100% 13.200 9.240 N Zbbx n/a
4 TRCN0000245404 GGTATCACAAGGATGACATAA pLKO_005 439 CDS 100% 13.200 9.240 N Zbbx n/a
5 TRCN0000241647 CTTCGTACCATGCTACCAAAT pLKO_005 48 5UTR 100% 10.800 7.560 N Zbbx n/a
6 TRCN0000200482 CAATAGTAGAACTGGATGATA pLKO.1 223 CDS 100% 5.625 3.938 N Zbbx n/a
7 TRCN0000192660 GAAGAGTTACAGGCATTCAAT pLKO.1 1317 CDS 100% 5.625 3.938 N Zbbx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.